SimpleSearch - Line and FST details


Line specific information

 
Line ID 278H07
Vector Used pAC161
Line Availability available as T3 set from NASC (N426683)
Segregation Analysis 50:46:38
Confirmed for Hit At5g38396
Parent of DUPLO pair none
Parent of pair(s) 94635, 94644, 94655, 94665, 94674, 94680, 94688, 94689, 94690, 94691, 94692, 94693, 94694

Gene hit At5g38396

 
Sequence (A. th genome BLAST matches underlined) 
>56-K015122-022-278-H07-8409
AAGATAACACTCTACGCAAATAATCGAATATCAATGTACCACCTTATGGTTAGGGGATAC
CATGAATAACAATACGACTGCGCGTGTCACAATGTATCCTGTGAAGAACAAAACTAATAG
CATAGGTTTTTACTACCATGAGAAATAAGCCTATTATTGGTCCCGTGAAATCTATGGGAT
CCTCCCTTNAGTGA
GenBank Accession AL944028 [GenBank]
Graphic View Graphic view of gene At5g38396
Predicted Position of Insertion Chr5:15374639 - go to primer design
BLAST e Value 2e-39
Hit Clone Code (BAC ID) MXI10
Hit Gene Code At5g38396 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box/RNI-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37