SimpleSearch - Line and FST details


Line specific information

 
Line ID 280C07
Vector Used pAC161
Line Availability available as T3 set from NASC (N426815)
Segregation Analysis 50:42:35
Confirmed for Hit At5g11790
Parent of DUPLO pair none
Parent of pair(s) 741, 3141

Gene hit At5g11790

 
Sequence (A. th genome BLAST matches underlined) 
>51-K015176-022-280-C07-8409
CTGATCCATGTAGATTTCCCGGACATGACACCCATACACATTACTGCACCAAGTCTGGAC
AAGAGACGACAAGAAATAATAAGGAGAAAATTCTATTTCTATATAGGCAAAAAAGTTTTG
GTTTTCTTTCTTCTGCCTAGGGGATCC
GenBank Accession AL944197 [GenBank]
Graphic View Graphic view of gene At5g11790
Predicted Position of Insertion Chr5:3801306 - go to primer design
BLAST e Value 3e-54
Hit Clone Code (BAC ID) T22P22
Hit Gene Code At5g11790 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation N-MYC downregulated-like 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37