SimpleSearch - Line and FST details


Line specific information

 
Line ID 280E07
Vector Used pAC161
Line Availability available as T3 set from NASC (N426839)
Segregation Analysis 50:45:12
Confirmed for Hit At5g19010
Parent of DUPLO pair none
Parent of pair(s) 84315, 84321, 84326, 84335, 84337

Gene hit At5g19010

 
Sequence (A. th genome BLAST matches underlined) 
>53-K015176-022-280-E07-8409
CTGATCCATTGTAGATTTCCCGACATGAANGCCTTTACAATTTAAATACTATCAGTGTTA
GGTCGGTGATCTGGATTTAGGTCGGTAGATTTTGTATATATACTTTCATCGAATGTTTCA
AATTTTCATAGGGAATCTATGGGATCCTCCCTATAGTGAGA
GenBank Accession AL944230 [GenBank]
Graphic View Graphic view of gene At5g19010
Predicted Position of Insertion Chr5:6346740 - go to primer design
BLAST e Value 7e-21
Hit Clone Code (BAC ID) T16G12
Hit Gene Code At5g19010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitogen-activated protein kinase 16
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37