SimpleSearch - Line and FST details


Line specific information

 
Line ID 285G03
Vector Used pAC161
Line Availability available as T3 set from NASC (N427339)
Segregation Analysis 50:14:13
Confirmed for Hit At1g30070
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g30070

 
Sequence (A. th genome BLAST matches underlined)
>23-K015290-022-285-G03-8409
NTGATCCATGGTAGATTTCCCGGACCTGAANGCCTTTACAATTGAATATATCCTGATCAA
GCCAAAGCGAAGGGAACGAGAGAGTCTTGTGGAAACTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL944917 [GenBank]
Graphic View Graphic view of gene At1g30070
Predicted Position of Insertion Chr1:10548161 - go to primer design
BLAST e Value 3e-11
Hit Clone Code (BAC ID) T1P2
Hit Gene Code At1g30070 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SGS domain-containing protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL944917 [GenBank]


Last Updated on 10.06.2021 13:37