SimpleSearch - Line and FST details


Line specific information

 
Line ID 286A12
Vector Used pAC161
Line Availability available as T3 set from NASC (N427372)
Segregation Analysis 50:45:34
Confirmed for Hit At5g27310
Parent of DUPLO pair none
Parent of pair(s) 59652, 92872, 92873

Gene hit At5g27310

 
Sequence (A. th genome BLAST matches underlined)
>89-K015496-022-286-A12-8409
GATACTCTCCTTGGCAAATCTCACTCTCATCATCTTTCCGTCGTTCTTGATCATCAGGTG
ACTATGGGATCCTCCCTATAGTGAGCAAGACCAAATCATTCGAGGCAGAATAAATCACCA
TTATAATTGGACCTATGTCTAAGACCCACGCAGAGAAAATCTTACAGATGCTTTGAAAGA
TAAGGGGATGAGTTAAGACTTGATGAGTACACTA
GenBank Accession AL944962 [GenBank]
Graphic View Graphic view of gene At5g27310
Predicted Position of Insertion Chr5:9625533 - go to primer design
BLAST e Value 8e-21
Hit Clone Code (BAC ID) F21A20
Hit Gene Code At5g27310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transcription factor IIS family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL944962 [GenBank]


Last Updated on 10.06.2021 13:37