SimpleSearch - Line and FST details


Line specific information

 
Line ID 288D01
Vector Used pAC161
Line Availability available as T3 set from NASC (N427589)
Segregation Analysis 50:48:46
Confirmed for Hit At4g22180
Parent of DUPLO pair none
Parent of pair(s) 63200, 94590, 94592

Gene hit At4g22180

 
Sequence (A. th genome BLAST matches underlined) 
>04-K015351-022-288-D01-8409
GCTGGTGCTATCTTGAAAGATTTGTTGAGGAATCTCCCTATGGGATCCTCCCTATAGTGA
GAACTTGTTGTCACAGTAACTGGAGATGTCCTTAAGGTTGACAGACTCGTGGAGAAAGAG
ACTATGGGATCCTCCCTATA
GenBank Accession AL945293 [GenBank]
Graphic View Graphic view of gene At4g22180
Predicted Position of Insertion Chr4:11739356 - go to primer design
BLAST e Value 1e-22
Hit Clone Code (BAC ID) T10I14
Hit Gene Code At4g22180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box protein (DUF295)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL945292 [GenBank]


Last Updated on 10.06.2021 13:37