SimpleSearch - Line and FST details


Line specific information

 
Line ID 290B03
Vector Used pAC161
Line Availability available as T3 set from NASC (N427759)
Segregation Analysis 50:50:32
Confirmed for Hit At3g03220
Parent of DUPLO pair none
Parent of pair(s) 6467, 6482, 6487, 6499, 90628, 90644, 90765, 90775, 90827, 90830, 90832

Gene hit At3g03220

 
Sequence (A. th genome BLAST matches underlined) 
>18-K015353-022-290-B03-8409
NTTCTGATCCATGGTAGATTTCCCGGACCATGTAAGTACTAACTCTAACTTAAGTGATAT
GCAACTAACTATTTATAGGCTCAGCTCCAAAACACTTCACAAACTAATAAAGGATCTAAT
GATCCATTGTATCATGAACCTAAATAGTAGTTTACCGCATTGTGCCTATGGGATCCTCCC
TATAGTGAG
GenBank Accession AL945534 [GenBank]
Graphic View Graphic view of gene At3g03220
Predicted Position of Insertion Chr3:743013 - go to primer design
BLAST e Value 3e-63
Hit Clone Code (BAC ID) T17B22
Hit Gene Code At3g03220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation expansin A13
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL945534 [GenBank]


Last Updated on 10.06.2021 13:37