SimpleSearch - Line and FST details


Line specific information

 
Line ID 297H09
Vector Used pAC161
Line Availability available as T3 set from NASC (N428509)
Segregation Analysis 50:30:21
Confirmed for Hit At3g07990
Parent of DUPLO pair none
Parent of pair(s) 1041, 7748, 7753, 7762, 7779, 9382, 11032, 73781, 73840, 73879, 73888

Gene hit At3g07990

 
Sequence (A. th genome BLAST matches underlined) 
>72-K015553-022-297-H09-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGATTTA
GACAGTACTCAGGCTATGTCACTGTGCATGAAGAACGTGGAAGAGCTTTGTTCTACTGGT
TGGTCGAGTCTCCGTTGGCCCGTGACCCAAAGTCTATGGGATACTTCCTAT
GenBank Accession AL946632 [GenBank]
Graphic View Graphic view of gene At3g07990
Predicted Position of Insertion Chr3:2552679 - go to primer design
BLAST e Value 2e-49
Hit Clone Code (BAC ID) F17A17
Hit Gene Code At3g07990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation serine carboxypeptidase-like 27
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL946632 [GenBank]


Last Updated on 10.06.2021 13:37