SimpleSearch - Line and FST details


Line specific information

 
Line ID 302F10
Vector Used pAC161
Line Availability available as T3 set from NASC (N428966)
Segregation Analysis 87:54:36
Confirmed for Hit At5g20040
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g20040

 
Sequence (A. th genome BLAST matches underlined) 
>78-K015559-022-302-F10-8409
TTTGATCCATGTAGATTTCCCGGACATGAAGCCTTTACAATTGAATCATGTGAAAGAATC
AAACAGAACTTCGACTTTCATTTATTCTCATCACTATTTCGTCCAAAGCTAATACACTAT
GGGATCCTCCCTATAGTGAGCTCCCTGCGTCGATGGGACCCGCCCTCTCTTGGGACC
GenBank Accession CR356300 [GenBank]
Graphic View Graphic view of gene At5g20040
Predicted Position of Insertion Chr5:6768532 - go to primer design
BLAST e Value 3e-20
Hit Clone Code (BAC ID) F28I16
Hit Gene Code At5g20040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation isopentenyltransferase 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR356301 [GenBank]


Last Updated on 10.06.2021 13:37