SimpleSearch - Line and FST details


Line specific information

 
Line ID 338B11
Vector Used pAC161
Line Availability available as T3 set from NASC (N432375)
Segregation Analysis 50:39:36
Confirmed for Hit At4g20800
Parent of DUPLO pair none
Parent of pair(s) 6604, 6612, 6616, 6617, 7855, 82440, 82516, 82532, 82551, 82584, 82600, 82623, 82634, 82663, 82668, 82683, 82684, 82685, 82686, 82687, 82688, 82689, 82690

Gene hit At4g20800

 
Sequence (A. th genome BLAST matches underlined) 
>82-K016159-022-338-B11-8409
TTTCCCGGACTGAAGCCAAACGCTGTCCTATTAATCCAGCTCATTTCGTAGAATCTTCAC
GATTTTAGCCCTAATTCAGGCAAATTCTTGTTGCATAATCGCCATGAGCCTCCTTGCTGA
GCCTAAAACTGAGCGTACCAACACAACTGCGATGGCTTTCTCGCTATGGGATCCTCCCTA
TAGTGAGAAAAC
GenBank Accession AL951721 [GenBank]
Graphic View Graphic view of gene At4g20800
Predicted Position of Insertion Chr4:11140687 - go to primer design
BLAST e Value 2e-46
Hit Clone Code (BAC ID) F21C20
Hit Gene Code At4g20800 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FAD-binding Berberine family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL951720 [GenBank]


Last Updated on 10.06.2021 13:37