SimpleSearch - Line and FST details


Line specific information

 
Line ID 363G01
Vector Used pAC161
Line Availability available as T3 set from NASC (N434825)
Segregation Analysis 50:42:42
Confirmed for Hit At1g15040
Parent of DUPLO pair none
Parent of pair(s) 2812, 96780

Gene hit At1g15040

 
Sequence (A. th genome BLAST matches underlined)
>07-K017000-022-363-G01-8409
TGATCATGAGATTTCCNGGACATGAGCCATTTACAATTGATATATCCTGACAACGTTGAG
AATCTGAGAGACACGTACAGAATGCCTAAGAAAGGAATGTTTCTTTCGAGACAGAGCCTA
GenBank Accession BX002372 [GenBank]
Graphic View Graphic view of gene At1g15040
Predicted Position of Insertion Chr1:5180889 - go to primer design
BLAST e Value 3e-17
Hit Clone Code (BAC ID) T15D22
Hit Gene Code At1g15040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Class I glutamine amidotransferase-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37