SimpleSearch - Line and FST details


Line specific information

 
Line ID 364F11
Vector Used pAC161
Line Availability available as T3 set from NASC (N434919)
Segregation Analysis 50:24:16
Confirmed for Hit At2g02020
Parent of DUPLO pair none
Parent of pair(s) 6294, 7792, 10597, 91320

Gene hit At2g02020

 
Sequence (A. th genome BLAST matches underlined) 
>86-K016996-022-364-F11-8409
AAGATTTTTATGCGGAAAAATCGCCTTTTTTCTCTTTTATATCACCACTTACATGTGTGA
CCGGTTCCCAATGAACGGCTTAGGGTTCCCAATGTACCGGATCCGGCTCCCAATGGACAG
GATTTGGATTCCCAATGTACTCGCTATCCACAGGAAAGAGACCTTTTACACCTTTTTCCC
CATGCTATGGGATCCTCCTTATACTGAGACTGGTTTTACTTCACTATCAACATTGGTGCT
TTTGTTTCATCTACTGTTCTATGGGATCCCCCTTATAGTGAG
GenBank Accession BX002486 [GenBank]
Graphic View Graphic view of gene At2g02020
Predicted Position of Insertion Chr2:479686 - go to primer design
BLAST e Value 2e-21
Hit Clone Code (BAC ID) F14H20
Hit Gene Code At2g02020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Major facilitator superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX002486 [GenBank]


Last Updated on 10.06.2021 13:37