SimpleSearch - Line and FST details


Line specific information

 
Line ID 372H02
Vector Used pAC161
Line Availability available as T3 set from NASC (N435702)
Segregation Analysis 50:50:40
Confirmed for Hit At1g06640
Parent of DUPLO pair none
Parent of pair(s) 5329, 5391, 7556, 8652, 10274, 10276, 10295, 11335, 65721, 95796, 95797, 95798, 95799, 95800, 95801

Gene hit At1g06640

 
Sequence (A. th genome BLAST matches underlined) 
>16-K017096-022-372-H02-8409
TGATCTGTAGATTTCCCGGACATGATGCACTTTACATTGAAGTCTTTCGTGTACACGAGA
GCAACTTTCATATCTCTTTACTCGTTCTTGGTGGATTCTTTCAGGGATGTTATGATGGAA
TACTCAAAGCAAGTGATGATTTTGGGTGAATTTCTGTTTGAGCTTTTGTCAGAAGCACTA
TGGGATCTCCNCTATAGTGAG
GenBank Accession BX003541 [GenBank]
Graphic View Graphic view of gene At1g06640
Predicted Position of Insertion Chr1:2033024 - go to primer design
BLAST e Value 1e-59
Hit Clone Code (BAC ID) F12K11
Hit Gene Code At1g06640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX003540 [GenBank]


Last Updated on 10.06.2021 13:37