SimpleSearch - Line and FST details
Line specific information
| Line ID | 380F11 |
| Vector Used | pAC161 |
| Line Availability | available as T3 set from NASC (N436455) |
| Segregation Analysis | 50:50:49 |
| Confirmed for Hit | At4g21450 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 2968, 9622 |
Gene hit At4g21450
| Sequence (A. th genome BLAST matches underlined) | >86-K017232-022-380-F11-8409 AGAGAGATTTCTCTGGAATTACAGTCTTTTTTTCATTGTCTATGGGATCCTCCCTATAGT GAG |
| GenBank Accession | BX004505 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr4:11426417 - go to primer design |
| BLAST e Value | 1e-10 |
| Hit Clone Code (BAC ID) | F18E5 |
| Hit Gene Code | At4g21450 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | PapD-like superfamily protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
| Other FSTs Supporting this Hit | BX004505 [GenBank] |
|
Last Updated on 10.06.2021 13:37 |
gabi-kat.de 
