SimpleSearch - Line and FST details


Line specific information

 
Line ID 386A11
Vector Used pAC161
Line Availability available as T3 set from NASC (N436971)
Segregation Analysis 50:49:48
Confirmed for Hit At3g01290
Parent of DUPLO pair none
Parent of pair(s) 97354, 97356, 97358

Gene hit At3g01290

 
Sequence (A. th genome BLAST matches underlined) 
>81-K018249w-022-386-A11-8409
TGATCTGAAATTTCCNGGACATGAAGCCATTTACATTGAATATGATGGCCTGTAATAATC
CATTTCGAATCTGCGCTGCCACGTCAGAGACGGCGCCTGGACCGTGAGGGATAAACACCG
CAGAGGATTTAGAAGTTGCTCCGATATCTCTCATTGTGTCAAAGTACTGAGTCATCATCA
CCATGTCCAACACATCCTTCGCTGACGTCCCTGGCACGTTTCCTGCGAACCCTATGGGAT
CCCCCCTATAGTGAG
GenBank Accession BX285851 [GenBank]
Graphic View Graphic view of gene At3g01290
Predicted Position of Insertion Chr3:88266 - go to primer design
BLAST e Value 1e-102
Hit Clone Code (BAC ID) T4P13
Hit Gene Code At3g01290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SPFH/Band 7/PHB domain-containing membrane-associated protein family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX285851 [GenBank]


Last Updated on 10.06.2021 13:37