SimpleSearch - Line and FST details


Line specific information

 
Line ID 386E04
Vector Used pAC161
Line Availability available as T3 set from NASC (N437012)
Segregation Analysis 50:50:40
Confirmed for Hit At4g02160
Parent of DUPLO pair 1465
Parent of pair(s) none

Gene hit At4g02160

 
Sequence (A. th genome BLAST matches underlined) 
>29-K018249w-022-386-E04-8409
CTCACAATAAACTCCTCAGTTTTCGCATCATTCATCTCAGCACCTCCTTCATCATTACCA
TAATTTTCATCATCATCATCATCTTCATCAAGACAATCCATATCTCGCAACGACTTTGCT
GATCCATATCCCGAGATTCCCGAAAAGCAAAAACTATGGGATCCTCCCCATGG
GenBank Accession BX285902 [GenBank]
Graphic View Graphic view of gene At4g02160
Predicted Position of Insertion Chr4:954974 - go to primer design
BLAST e Value 2e-24
Hit Clone Code (BAC ID) T10M13
Hit Gene Code At4g02160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cotton fiber protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX285902 [GenBank]


Last Updated on 10.06.2021 13:37