SimpleSearch - Line and FST details


Line specific information

 
Line ID 393H02
Vector Used pAC161
Line Availability available as T3 set from NASC (N437718)
Segregation Analysis 50:50:36
Confirmed for Hit At1g26390
Parent of DUPLO pair none
Parent of pair(s) 6616, 10682, 10683, 10690, 10698, 11057, 82429, 82467, 82468, 82469, 82470, 82471, 82472, 82473, 82474, 82476, 82477, 82478, 82479, 82480, 82481, 82482, 82483, 82484

Gene hit At1g26390

 
Sequence (A. th genome BLAST matches underlined) 
>16-K018296-022-393-H02-8409
TGATCATGTAGATTCCNGGACATGAGCCATTTACAATTGAATACCGTAGTCATGACCGCC
GCTTCGTATACGGAGCTGGATACCATTGGACTTTGCGCAGACCACCGTGGCCTGAACATG
AGATACATGTTTNTGCGGCCACGATGGCTATGGGATCTCCCCCTATA
GenBank Accession BX286770 [GenBank]
Graphic View Graphic view of gene At1g26390
Predicted Position of Insertion Chr1:9131422 - go to primer design
BLAST e Value 4e-47
Hit Clone Code (BAC ID) T1K7
Hit Gene Code At1g26390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FAD-binding Berberine family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX286769 [GenBank]


Last Updated on 10.06.2021 13:37