SimpleSearch - Line and FST details


Line specific information

 
Line ID 408D04
Vector Used pAC161
Line Availability available as T3 set from NASC (N439112)
Segregation Analysis 50:49:41
Confirmed for Hit At3g11180
Parent of DUPLO pair none
Parent of pair(s) 3345, 8166, 69411

Gene hit At3g11180

 
Sequence (A. th genome BLAST matches underlined) 
>28-K017955-022-409-D04-8409
ATTTCCCGGAATGAAGCCTTTAATGAAGTACAATATATGTTAGTCATGCAATAGATGCAA
TTTTCAATACTAACGTATATGTTTCTCTTGTGAAAACCGGCAGATACTAAGCAATTCGAA
ATACAAGAGCGTGGAACATCGAGTGATAGTGAATTCGGAAAAAGAAAGGGTTTCGCTATG
GGATCCTCCCTATAGTGAGATGCCCCAAAATGACCNTCTTACTCATTGCTGATCCTTGAA
GATTGCCCGGGCACGAAGCCCTTTGATGAAGTGCAATATCTGTTA
GenBank Accession CT026352 [GenBank]
Graphic View Graphic view of gene At3g11180
Predicted Position of Insertion Chr3:3506355 - go to primer design
BLAST e Value 6e-83
Hit Clone Code (BAC ID) F11B9
Hit Gene Code At3g11180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37