SimpleSearch - Line and FST details


Line specific information

 
Line ID 412E06
Vector Used pAC161
Line Availability available as T3 set from NASC (N439510)
Segregation Analysis 50:50:38
Confirmed for Hit At4g00430
Parent of DUPLO pair none
Parent of pair(s) 5303, 5309, 5330, 7552, 89549, 89564, 89577, 89585, 89586, 89587, 89588, 89589

Gene hit At4g00430

 
Sequence (A. th genome BLAST matches underlined) 
>45-K017997-022-412-E06-8409
CGAACACATGTTACGCAAAGATGTGAGCTTTATCTGAGAAATCAACAGTAAAATTGGTGT
AACATACAGATCTATGGGATCCTCCCTATAGTGAGANNAAAAAANAACCGAGTGATTACC
CCATTTTTTTCAGTTAACCCATCGGGATGACGACGGCG
GenBank Accession BX288351 [GenBank]
Graphic View Graphic view of gene At4g00430
Predicted Position of Insertion Chr4:186684 - go to primer design
BLAST e Value 2e-30
Hit Clone Code (BAC ID) F5I10
Hit Gene Code At4g00430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plasma membrane intrinsic protein 1;4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37