SimpleSearch - Line and FST details


Line specific information

 
Line ID 419F10
Vector Used pAC161
Line Availability available as T3 set from NASC (N440198)
Segregation Analysis 50:50:50
Confirmed for Hit At4g18610
Parent of DUPLO pair none
Parent of pair(s) 5302, 5424, 7541, 89768, 89784, 89785

Gene hit At4g18610

 
Sequence (A. th genome BLAST matches underlined) 
>78-K018139-022-419-F10-8409
GACCCGCCACCGTGTTCCTCCTAAGCAGCTCTAAACCGTCCAATCTCCGCACCTAATGGG
ATCCTCCCTATAGTGAGGTCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession FR809950 [GenBank]
Graphic View Graphic view of gene At4g18610
Predicted Position of Insertion Chr4:10251263 - go to primer design
BLAST e Value 4e-07
Hit Clone Code (BAC ID) F28A21
Hit Gene Code At4g18610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR809950 [GenBank]


Last Updated on 10.06.2021 13:37