SimpleSearch - Line and FST details


Line specific information

 
Line ID 421G12
Vector Used pAC161
Line Availability available as T3 set from NASC (N440404)
Segregation Analysis 50:50:41
Confirmed for Hit At5g13220
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g13220

 
Sequence (A. th genome BLAST matches underlined) 
>95-K018141-022-421-G12-8409
TGTCCTGTAGATTTCCCGGACATGAAGCCTCNGTTTCTTGTGATTTTTACCCCCAAATAT
CACAGAACGTTTTTATTTTTCTCTCTCTCGACCTTTTTTTTACTATAAGTTATTTAAGAT
AGTAATTATGGGTCCTGCCTCTTTTACTCTCACATACAACTTAAGATTCAACTATGGGAT
CCTCCCCTATAGTGAGANNGGGGCCTCCCCCCTTTACC
GenBank Accession BX288942 [GenBank]
Graphic View Graphic view of gene At5g13220
Predicted Position of Insertion Chr5:4220017 - go to primer design
BLAST e Value 2e-39
Hit Clone Code (BAC ID) T31B5
Hit Gene Code At5g13220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation jasmonate-zim-domain protein 10
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX288942 [GenBank]


Last Updated on 10.06.2021 13:37