SimpleSearch - Line and FST details


Line specific information

 
Line ID 438B10
Vector Used pAC161
Line Availability available as T3 set from NASC (N441974)
Segregation Analysis 50:50:24
Confirmed for Hit At1g20575
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g20575

 
Sequence (A. th genome BLAST matches underlined) 
>74-K018206-022-438-B10-8409
ATAGGGAGAATGGGATCATCCCTATAGTGAGACAAGTTTCTCAAATTGGGCCTAATATAA
ATATGGGCCTATATAAAGCCCAAAAATAAATCAGGAAAGATTTAAAAGAGGTAAACTCGT
CAATCGCATCTGAGTCGCTCTTCTTTCCTTCCGCCATTTTTTTCTTCCTATGGGATCCTC
CCTATAGTGAGAG
GenBank Accession BX290608 [GenBank]
Graphic View Graphic view of gene At1g20575
Predicted Position of Insertion Chr1:7128748 - go to primer design
BLAST e Value 2e-61
Hit Clone Code (BAC ID) F5M15
Hit Gene Code At1g20575 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleotide-diphospho-sugar transferases superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX290609 [GenBank]


Last Updated on 10.06.2021 13:37