SimpleSearch - Line and FST details


Line specific information

 
Line ID 440E01
Vector Used pAC161
Line Availability available as T3 set from NASC (N442193)
Segregation Analysis 50:37:26
Confirmed for Hit At5g25020
Parent of DUPLO pair none
Parent of pair(s) 68267, 97004, 97005

Gene hit At5g25020

 
Sequence (A. th genome BLAST matches underlined) 
>05-K018208-022-440-E01-8409
GATCATGAGATTTTCCGGAATGAAGCCATTTACAATTGATATATCCTGCATGTAGATTTC
CTTCCGCCGCACCCATCATTCTCCGCCGTTGCTGCGAACTCTTCTTCCCATCAACATCAT
CATAAATCACAAACGCCGACGATAACTCCATATGACAAATCCTATGGGATCCTCCCTATA
GTGAG
GenBank Accession BX290844 [GenBank]
Graphic View Graphic view of gene At5g25020
Predicted Position of Insertion Chr5:8619445 - go to primer design
BLAST e Value 2e-55
Hit Clone Code (BAC ID) T11H3
Hit Gene Code At5g25020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation enhanced disease resistance-like protein (DUF1336)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37