SimpleSearch - Line and FST details


Line specific information

 
Line ID 448C09
Vector Used pAC161
Line Availability available as T3 set from NASC (N442945)
Segregation Analysis 50:18:13
Confirmed for Hit At1g64090
Parent of DUPLO pair none
Parent of pair(s) 468, 3926, 3942, 3962

Gene hit At1g64090

 
Sequence (A. th genome BLAST matches underlined)
>67-K024503-022-448-C09-8409
ACCAGCAAACACCAAACCAAATCGGTTCGTTTATATCCTGATTTTCTGAATCTATACTCA
ATCCAAGCAACAAATCAAATCCTAAGTCTCAATCAATGGCTATGGGATCCTCCCTATAGT
GAGACGTATTACTCN
GenBank Accession BX943375 [GenBank]
Graphic View Graphic view of gene At1g64090
Predicted Position of Insertion Chr1:23789753 - go to primer design
BLAST e Value 4e-46
Hit Clone Code (BAC ID) F22C12
Hit Gene Code At1g64090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Reticulan like protein B3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX943376 [GenBank]


Last Updated on 10.06.2021 13:37