SimpleSearch - Line and FST details


Line specific information

 
Line ID 454E07
Vector Used pAC161
Line Availability available as T3 set from NASC (N2037851)
Segregation Analysis N/A (line seemingly not resistant, T2 plants grown without drug)
Confirmed for Hit At5g57710
Parent of DUPLO pair 11878
Parent of pair(s) none

Gene hit At5g57710

 
Sequence (A. th genome BLAST matches underlined) 
>53-K018837-022-454-E07-8409
TATCATGAAATTTCCCGGACATGAAGCCTTTACACTCATTGCCTAAACAGTTGCCACAGT
GGCTGTTGAAAGCTAAACCGGTTGATCTGTTTACCGGTAAGTTCCGGTTATTGAATCTTC
TCTTCAACAATTGCAATGGCTTTATGATATGATTGCAGATCATAAATTTATCAGTTTTGT
AATGTTTTTATTACAGCAAGCAAAGATGCAAGAAGTGCAGAAGAAATGGAATGATGCATG
CGTGCGTCTTCATCCTATGGGATCCTCCCCTATAGTGAG
GenBank Accession BX292478 [GenBank]
Graphic View Graphic view of gene At5g57710
Predicted Position of Insertion Chr5:23386222 - go to primer design
BLAST e Value 9e-110
Hit Clone Code (BAC ID) MRI1
Hit Gene Code At5g57710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX292477 [GenBank]


Last Updated on 10.06.2021 13:37