SimpleSearch - Line and FST details


Line specific information

 
Line ID 459G12
Vector Used pAC161
Line Availability available as T3 set from NASC (N444052)
Segregation Analysis 50:43:32
Confirmed for Hit At3g62750
Parent of DUPLO pair none
Parent of pair(s) 4815, 4881, 4894, 7380, 10161, 70407, 70473, 70681

Gene hit At3g62750

 
Sequence (A. th genome BLAST matches underlined) 
>95-K018854-022-459-G12-8409
TGATCTGANATTTCCCGGACTGAAGCCATTTTCACTTGAATATATCCTGACATCGATGGG
TATCGGTGTTTTCCATTTTTAATGTGTTCTTGTCTACTATTTGAGTTTTTTGGAGGATTT
TGTGGAAATAGTGGGAAGGACCTGCTATATGAAGACGGAAGAACTCCTAGGCCTT
GenBank Accession BX291123 [GenBank]
Graphic View Graphic view of gene At3g62750
Predicted Position of Insertion Chr3:23214524 - go to primer design
BLAST e Value 1e-28
Hit Clone Code (BAC ID) F26K9
Hit Gene Code At3g62750 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation beta glucosidase 8
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37