SimpleSearch - Line and FST details


Line specific information

 
Line ID 468D06
Vector Used pAC161
Line Availability available as T3 set from NASC (N444874)
Segregation Analysis 50:6:2
Confirmed for Hit At5g43640
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g43640

 
Sequence (A. th genome BLAST matches underlined)
>44-K019010-022-468-D06-8409
ATTTCCCGGACATGAGCCATTACCATATGATATATCCGTGGAATCCATTGACGGCTGAGC
CAATCAAAGCCATAGGTTTTCTGGTCAATCCCCTATGGGATCCTCCCTATAGTGA
GenBank Accession BX291850 [GenBank]
Graphic View Graphic view of gene At5g43640
Predicted Position of Insertion Chr5:17531579 - go to primer design
BLAST e Value 1e-07
Hit Clone Code (BAC ID) K9D7
Hit Gene Code At5g43640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein S19 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37