SimpleSearch - Line and FST details


Line specific information

 
Line ID 490C09
Vector Used pAC161
Line Availability available as T3 set from NASC (N446977)
Segregation Analysis 50:24:14
Confirmed for Hit At5g28520
Parent of DUPLO pair none
Parent of pair(s) 1983, 96922, 96929, 96947

Gene hit At5g28520

 
Sequence (A. th genome BLAST matches underlined) 
>67-K019645-022-490-C09-8409
GCCTGGCTATAACTCCGCGTTCATTTCCACTTGTTTTGCCCCCAAACCTTCCACCGTAGT
GATGTATTCACTCGGATAATCTATGGGATCCTCCCTATAGTGAGAGCTATGGGATCCTCC
CTATAGTGAGACCTTTGCCCTCCCCCTAATAAGAGGCCCCACCGC
GenBank Accession BX532333 [GenBank]
Graphic View Graphic view of gene At5g28520
Predicted Position of Insertion Chr5:10494685 - go to primer design
BLAST e Value 5e-28
Hit Clone Code (BAC ID) T26D3
Hit Gene Code At5g28520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mannose-binding lectin superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX532332 [GenBank]


Last Updated on 10.06.2021 13:37