SimpleSearch - Line and FST details


Line specific information

 
Line ID 491E10
Vector Used pAC161
Line Availability available as T3 set from NASC (N447098)
Segregation Analysis 50:11:9
Confirmed for Hit At4g17880
Parent of DUPLO pair none
Parent of pair(s) 2076, 3112

Gene hit At4g17880

 
Sequence (A. th genome BLAST matches underlined) 
>77-K019640-022-491-E10-8409
ACAACAACTACTACACAGTGTTGTTAGGTTGGGGAGATGGTTATTACAAAGGAGAAGAAG
AGAAGCCTATGGGATCTNCCCTATAGTGAGAGTCGCTTCCTCC
GenBank Accession CR770402 [GenBank]
Graphic View Graphic view of gene At4g17880
Predicted Position of Insertion Chr4:9935188 - go to primer design
BLAST e Value 7e-24
Hit Clone Code (BAC ID) T6K21
Hit Gene Code At4g17880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Basic helix-loop-helix (bHLH) DNA-binding family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR770403 [GenBank]


Last Updated on 10.06.2021 13:37