SimpleSearch - Line and FST details


Line specific information

 
Line ID 498F11
Vector Used pAC161
Line Availability available as T3 set from NASC (N447783)
Segregation Analysis 50:14:14
Confirmed for Hit At2g30830
Parent of DUPLO pair none
Parent of pair(s) 5372, 5388, 5391, 10356, 11345, 95808, 95814, 95829, 95843, 95857, 95858, 95859, 95860, 95861, 95862

Gene hit At2g30830

 
Sequence (A. th genome BLAST matches underlined) 
>86-K019699-022-498-F11-8409
CATACCGACAAATCACGGGTAAGTCCCCTGCTTGTGCAACGTCTGGAAGGATGACCTTCT
TTTGATGAAAATGTTGTCCTCATCTCCTATGATAGGATCCCTACAATAAGGAG
GenBank Accession BX533198 [GenBank]
Graphic View Graphic view of gene At2g30830
Predicted Position of Insertion Chr2:13133655 - go to primer design
BLAST e Value 2e-11
Hit Clone Code (BAC ID) F7F1
Hit Gene Code At2g30830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37