SimpleSearch - Line and FST details


Line specific information

 
Line ID 499D03
Vector Used pAC161
Line Availability available as T3 set from NASC (N447847)
Segregation Analysis 50:11:9
Confirmed for Hit At1g66280
Parent of DUPLO pair none
Parent of pair(s) 70183, 70210, 70341, 70413, 70477, 70554, 70555, 70559, 70565

Gene hit At1g66280

 
Sequence (A. th genome BLAST matches underlined) 
>20-K019685-022-499-D03-8409
TGAGTCACGCTGGTGTGAAATTCTACCACGACCTGATCGATGAGCTCCTTAAAAATGGTT
ATATACATATAAACTAATTAATTAAAAAAGACAAGAAATATAGTATCATTATTTAACATT
TCTATCTATTTTTACATTGTAGCTATGGGATCTCCCCTATAGTGAGATTCTCGGATCCTC
CCTATCGCGGGCTATCCTGAA
GenBank Accession BX533259 [GenBank]
Graphic View Graphic view of gene At1g66280
Predicted Position of Insertion Chr1:24708662 - go to primer design
BLAST e Value 2e-71
Hit Clone Code (BAC ID) T27F4
Hit Gene Code At1g66280 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Glycosyl hydrolase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX533260 [GenBank]


Last Updated on 10.06.2021 13:37