SimpleSearch - Line and FST details


Line specific information

 
Line ID 502A09
Vector Used pAC161
Line Availability available as T3 set from NASC (N448105)
Segregation Analysis 50:48:36
Confirmed for Hit At1g29680
Parent of DUPLO pair none
Parent of pair(s) 287, 2896

Gene hit At1g29680

 
Sequence (A. th genome BLAST matches underlined)
>65-K019715-022-502-A09-8409
ACAATTAGTTATCCGGACTCAGACGTTAACTAGTTCAAACATTAATCAGAATCATAGAAA
TTCTATGGGATCCTCCCTATAGTGAGACGAATGGAATCCCCCTTTCCCGGTGGTATGGGA
ACCTCCACA
GenBank Accession BX533578 [GenBank]
Graphic View Graphic view of gene At1g29680
Predicted Position of Insertion Chr1:10378292 - go to primer design
BLAST e Value 8e-24
Hit Clone Code (BAC ID) F15D2
Hit Gene Code At1g29680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone acetyltransferase (DUF1264)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX533577 [GenBank]


Last Updated on 10.06.2021 13:37