SimpleSearch - Line and FST details


Line specific information

 
Line ID 510A05
Vector Used pAC161
Line Availability available as T3 set from NASC (N448869)
Segregation Analysis 50:48:40
Confirmed for Hit At1g34050
Parent of DUPLO pair 12237
Parent of pair(s) none

Gene hit At1g34050

 
Sequence (A. th genome BLAST matches underlined) 
>33-K019520-022-510-A05-8409
GATATATCCTGATGAGTAATAACGATCAGTAACGTATCATGTAGAGACCAGAATTTTTTA
TTAGTCCCCTCCCAAGTGTTCAAATCCGCGACCCCTATGGGATCCTCCCTATAGTGAGA
GenBank Accession BX534489 [GenBank]
Graphic View Graphic view of gene At1g34050
Predicted Position of Insertion Chr1:12394405 - go to primer design
BLAST e Value 7e-18
Hit Clone Code (BAC ID) F12G12
Hit Gene Code At1g34050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ankyrin repeat family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX534489 [GenBank]


Last Updated on 10.06.2021 13:37