SimpleSearch - Line and FST details


Line specific information

 
Line ID 512A09
Vector Used pAC161
Line Availability available as T3 set from NASC (N449065)
Segregation Analysis 50:49:30
Confirmed for Hit At1g69630
Parent of DUPLO pair none
Parent of pair(s) 3810, 9840, 9848, 85384, 85393, 85394, 85396, 85397, 85398, 85399

Gene hit At1g69630

 
Sequence (A. th genome BLAST matches underlined) 
>65-K019922-022-512-A09-8409
GATCTGANATTTCCCGGACTGAAGCCATTTACATTGAATATATCCTGTAATGATGGGTCA
TACTCGTCATCACAATCATACTTCAAGATAAATTTTTGTAAGAATGATTCACTGTTGAAA
TCGAGAAAGCTATCAACAAAACTCAAGAATGTGTTGAACTCTTGGAAATCAGTATTGCCT
ATGGGATCTCCNCTATAGTGAGACTCTGGGATCCGCCCGATCCCGCGCTAACCTGAATGG
ATACCCCCATGGGATCCCCCCCATAATGA
GenBank Accession BX534767 [GenBank]
Graphic View Graphic view of gene At1g69630
Predicted Position of Insertion Chr1:26192864 - go to primer design
BLAST e Value 3e-63
Hit Clone Code (BAC ID) F24J1
Hit Gene Code At1g69630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box/RNI-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37