SimpleSearch - Line and FST details


Line specific information

 
Line ID 514G05
Vector Used pAC161
Line Availability available as T3 set from NASC (N449325)
Segregation Analysis 50:18:14
Confirmed for Hit At1g60070
Parent of DUPLO pair 12856
Parent of pair(s) none

Gene hit At1g60070

 
Sequence (A. th genome BLAST matches underlined) 
>39-K019931-022-514-G05-8409
GATGCTGAAATTTCCGGACATGAAGCCTTTAAATTGAATATGTTGCAGGAAAATGATCAT
GATAGATTTTAATTGAGATGGACCCATCCTTATGAAGGAAAGTACATCCCCTTATGACAC
AGAAAGTAACCGCTGATACCATTTTCTTCATTTTATTATCAAGCAGAAAACTAG
GenBank Accession FR811490 [GenBank]
Graphic View Graphic view of gene At1g60070
Predicted Position of Insertion Chr1:22145290 - go to primer design
BLAST e Value 2e-18
Hit Clone Code (BAC ID) T2K10
Hit Gene Code At1g60070 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Adaptor protein complex AP-1, gamma subunit
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR811490 [GenBank]


Last Updated on 10.06.2021 13:37