SimpleSearch - Line and FST details


Line specific information

 
Line ID 514H03
Vector Used pAC161
Line Availability available as T3 set from NASC (N449335)
Segregation Analysis 50:27:25
Confirmed for Hit At2g36530
Parent of DUPLO pair none
Parent of pair(s) 2983, 9621

Gene hit At2g36530

 
Sequence (A. th genome BLAST matches underlined) 
>24-K019931-022-514-H03-8409
TGACCATCACATATACTCATTGCTTTTTCTCCGTATTGACCATCATACCCTGAATTTTTG
TCCTTCACCATCTCCGTCAAGTGCATGGACCATGAAGTTGTCAATAGCAGTCTGCTGAGT
TGGGCCCTGCAAGAAATAATACTAGCAACGAGAATAAAATGAGTGAGTCTATGGGATGCT
CCCTAT
GenBank Accession BX535082 [GenBank]
Graphic View Graphic view of gene At2g36530
Predicted Position of Insertion Chr2:15322802 - go to primer design
BLAST e Value 3e-32
Hit Clone Code (BAC ID) F1O11
Hit Gene Code At2g36530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Enolase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX535082 [GenBank]


Last Updated on 10.06.2021 13:37