SimpleSearch - Line and FST details


Line specific information

 
Line ID 517G12
Vector Used pAC161
Line Availability available as T3 set from NASC (N449620)
Segregation Analysis 50:43:31
Confirmed for Hit At3g50820
Parent of DUPLO pair none
Parent of pair(s) 7899

Gene hit At3g50820

 
Sequence (A. th genome BLAST matches underlined) 
>95-K019945-022-515-G12-8409
GTAGTGAGAGANCATTTTCCANCGAAGTCTTTGTGGTCATAGTGGAGAGAGCACGTGAGC
CTATGGGATCCTCCCTATAGTGAGANCNNNNNCCTCNANNNCCNACCTCTGGTCGTTGGT
ATTTTTATCGGAATATACTATACTTTTTTTTCTAGTTTGTTGACTTTTCCTTCCCCCATG
CTACCCTCACGAGGAAGTTGGGCTTTCCAGGGTCGGGGACGCACACGCGGAGGCGTGACT
CTTTNTNTGGCCTTNTCAAAAGTTAAACACAGGA
GenBank Accession BX535218 [GenBank]
Graphic View Graphic view of gene At3g50820
Predicted Position of Insertion Chr3:18891992 - go to primer design
BLAST e Value 1e-13
Hit Clone Code (BAC ID) F18B3
Hit Gene Code At3g50820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation photosystem II subunit O-2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37