SimpleSearch - Line and FST details


Line specific information

 
Line ID 521C04
Vector Used pAC161
Line Availability available as T3 set from NASC (N449948)
Segregation Analysis 50:42:40
Confirmed for Hit At1g48150
Parent of DUPLO pair none
Parent of pair(s) 11774

Gene hit At1g48150

 
Sequence (A. th genome BLAST matches underlined) 
>27-K020205-022-521-C04-8409
TGAGAATAAAGAAAAATCAGACTCCCGTTTCTAAATCCGATCAAAACCCTAACAACGACA
GTGGGTCTTCTTCTTCGTCTTCTCAAATTGCTTCTGATTTTGGTCAAAACTCTATGGGAT
CCTCCCTATAGTGAGA
GenBank Accession BX535774 [GenBank]
Graphic View Graphic view of gene At1g48150
Predicted Position of Insertion Chr1:17785756 - go to primer design
BLAST e Value 9e-44
Hit Clone Code (BAC ID) F21D18
Hit Gene Code At1g48150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation MADS-box transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX535774 [GenBank]


Last Updated on 10.06.2021 13:37