SimpleSearch - Line and FST details


Line specific information

 
Line ID 522H08
Vector Used pAC161
Line Availability available as T3 set from NASC (N450108)
Segregation Analysis 50:45:33
Confirmed for Hit At3g06990
Parent of DUPLO pair none
Parent of pair(s) 91535, 91543

Gene hit At3g06990

 
Sequence (A. th genome BLAST matches underlined) 
>64-K020204-022-522-H08-8409
GAGACTTCTGGAAACAACATGTGGTATAAAGGATGGGGATGCACTTCATGGAGAAAAGGC
TCAGAAATGGATCCACACCGCACATCAAATTTATCAAACGTTGTCTTGTACCTGAAGCCA
TCGAATAATTTTTGACAACTTCTACACTTGTAATGGTTGCCAGCCTTATTTTTTACCCTT
AGATCAAGCTTGTCGATGTGCAAGATACTTCGTTTCCTCCGAGGGAGGCTATGGGATCCT
CCCTATAGTGAG
GenBank Accession BX536003 [GenBank]
Graphic View Graphic view of gene At3g06990
Predicted Position of Insertion Chr3:2207604 - go to primer design
BLAST e Value 5e-110
Hit Clone Code (BAC ID) F17A9
Hit Gene Code At3g06990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cysteine/Histidine-rich C1 domain family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37