SimpleSearch - Line and FST details


Line specific information

 
Line ID 528B11
Vector Used pAC161
Line Availability available as T3 set from NASC (N450615)
Segregation Analysis 50:32:26
Confirmed for Hit At4g17350
Parent of DUPLO pair none
Parent of pair(s) 3122, 9665

Gene hit At4g17350

 
Sequence (A. th genome BLAST matches underlined)
>82-K020333-022-528-B11-8409
ATCTTCTCAAGAAAAAAGAATACTCGCGATCGGGAAAACGCACACGTGCATTCTGCCGTC
TCAATAGCGGCTCTGGCTGCGGGATCACCCTCTGTGACGTGTGCTATGGGATCCTCCCTA
TAGTGAG
GenBank Accession BX536489 [GenBank]
Graphic View Graphic view of gene At4g17350
Predicted Position of Insertion Chr4:9702164 - go to primer design
BLAST e Value 8e-13
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g17350 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation auxin canalization protein (DUF828)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37