SimpleSearch - Line and FST details


Line specific information

 
Line ID 529B11
Vector Used pAC161
Line Availability available as T3 set from NASC (N450711)
Segregation Analysis 50:8:8
Confirmed for Hit At1g16520
Parent of DUPLO pair 2542
Parent of pair(s) none

Gene hit At1g16520

 
Sequence (A. th genome BLAST matches underlined)
>82-K020702-022-529-B11-8409
TCCCTAAGATAAAGGGCTCCTGTGAATTACAAATGAATCAGAAAAAGATCAACAATTTCA
TATTCTGGTTAATGAAAAACCGACACTATGGGATCCTCCCTATAGTGAGNNNNNNNNNNN
N
GenBank Accession BX546589 [GenBank]
Graphic View Graphic view of gene At1g16520
Predicted Position of Insertion Chr1:5650827 - go to primer design
BLAST e Value 2e-29
Hit Clone Code (BAC ID) F3O9
Hit Gene Code At1g16520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation interactor of constitutive active ROPs protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37