SimpleSearch - Line and FST details


Line specific information

 
Line ID 533E08
Vector Used pAC161
Line Availability available as T3 set from NASC (N451128)
Segregation Analysis 50:36:23
Confirmed for Hit At5g22460
Parent of DUPLO pair none
Parent of pair(s) 4914, 4920, 4943, 4958, 92274, 92286, 92288

Gene hit At5g22460

 
Sequence (A. th genome BLAST matches underlined) 
>61-K020374-022-533-E08-8409
TTTACAATTGAAAGAATTTTTCATTGCATTTAAGATTGTGGTTGCTTCAAAAGTCAATTT
TGCGTTTGCGCCTATGGGATCCTCCCTATAGTGAGAANTAAGAAATCTACCTATTATCGA
TTTTTTTTTCATTCTTAAATGCAAATGTCCCCACCGTTATTATAGGAACCTTTGGAACCT
TCCTAAAAAGGGAATTTTGGGAT
GenBank Accession BX546719 [GenBank]
Graphic View Graphic view of gene At5g22460
Predicted Position of Insertion Chr5:7444654 - go to primer design
BLAST e Value 2e-23
Hit Clone Code (BAC ID) MWD9
Hit Gene Code At5g22460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CU589554 [GenBank]


Last Updated on 10.06.2021 13:37