SimpleSearch - Line and FST details


Line specific information

 
Line ID 535B06
Vector Used pAC161
Line Availability available as T3 set from NASC (N451282)
Segregation Analysis 50:47:35
Confirmed for Hit At4g28650
Parent of DUPLO pair none
Parent of pair(s) 1660, 2836, 3272

Gene hit At4g28650

 
Sequence (A. th genome BLAST matches underlined) 
>42-K020487-022-535-B06-8409
ATCAAGGAGAGAAATGTCTATGGGATCCTCCCTATAGTGAGACCGCTAAAATCCCCCTTT
GCCCCCGTCCATTGATCTCCCTTCTTCCCCATGAGCTCCAGTGGATCCTCCCCAATATGT
GAGCCTCCTTTAAGACCGACTCTCGGAGACCCCTTTTATCTCACAGTCCGTTCTCCTTCG
CTCTCACGCTCGCCGGCGATGAATCCGTTAGAATAACATTTCTTGTACCCACTCCTCCTA
TCAATCGTGACAATCCC
GenBank Accession FR811795 [GenBank]
Graphic View Graphic view of gene At4g28650
Predicted Position of Insertion Chr4:14145048 - go to primer design
BLAST e Value 2e-04
Hit Clone Code (BAC ID) T5F17
Hit Gene Code At4g28650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat transmembrane protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX546856 [GenBank] FR811795 [GenBank]


Last Updated on 10.06.2021 13:37