SimpleSearch - Line and FST details


Line specific information

 
Line ID 554G10
Vector Used pAC161
Line Availability available as T3 set from NASC (N453170)
Segregation Analysis 50:38:24
Confirmed for Hit At5g48360
Parent of DUPLO pair 2646
Parent of pair(s) none

Gene hit At5g48360

 
Sequence (A. th genome BLAST matches underlined) 
>79-K022300-022-545-G10-8409
GGATGAGCCATTTACAATTGAATATATCCTCGTATCTTCCTTACTCTTAGTCTCTCCGGT
GACGGAGACTGGAGGTTAGTGGCGTCTGAGTATCTATGGGATCCTCCCTATAGTGAGACT
AAGTAATCCTCCCTATAATAGTGCTGCGGACATCTACATTTTTGAATTGAAAAAAA
GenBank Accession BX650411 [GenBank]
Graphic View Graphic view of gene At5g48360
Predicted Position of Insertion Chr5:19596583 - go to primer design
BLAST e Value 3e-27
Hit Clone Code (BAC ID) K23F3
Hit Gene Code At5g48360 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Actin-binding FH2 (formin homology 2) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX651052 [GenBank]


Last Updated on 10.06.2021 13:37