SimpleSearch - Line and FST details


Line specific information

 
Line ID 565B09
Vector Used pAC161
Line Availability available as T3 set from NASC (N454165)
Segregation Analysis 60:42:32
Confirmed for Hit At1g65880
Parent of DUPLO pair none
Parent of pair(s) 70691, 70703, 70714, 70724, 70733, 70742, 70744, 70747, 70748, 70749

Gene hit At1g65880

Sequence (A. th genome BLAST matches underlined)
>66-K023141-022-565-B09-8409
CGCTTCTCTAACTCTCTCTTACACTCTCCAAGAACGATGTGGTATGCCGCGTTATTGGAG
TGCAATATTTCTACATTTAAGCCCATCTGGATAAAACTATAGTTGTGATAACAAGATTTA
TTATGTTTATT
GenBank Accession BX891791 [GenBank]
Graphic View Graphic view of gene At1g65880
Predicted Position of Insertion Chr1:24510579 - go to primer design
BLAST e Value 6e-42
Hit Clone Code (BAC ID) F12P19
Hit Gene Code At1g65880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation benzoyloxyglucosinolate 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details