SimpleSearch - Line and FST details


Line specific information

 
Line ID 571C09
Vector Used pAC161
Line Availability available as T3 set from NASC (N454753)
Segregation Analysis 50:47:37
Confirmed for Hit At5g04380
Parent of DUPLO pair none
Parent of pair(s) 4791, 4821, 4937, 4952, 7416, 10144
Note

Gene hit At2g13630

 
Sequence (A. th genome BLAST matches underlined) 
>67-K023195-022-571-C09-8409
ATTGAATATATCCTAGGATAATGACCATGAGTATACTTACATTCCAGCATTCTCCATTTT
TGTTTTGCTCCTATGGGATCCTCCCTATAATGA
GenBank Accession BX891887 [GenBank]
Graphic View Graphic view of gene At2g13630
Predicted Position of Insertion Chr2:5685034 - go to primer design
BLAST e Value 1e-21
Hit Clone Code (BAC ID) T10F5
Hit Gene Code At2g13630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box associated ubiquitination effector family protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 606E12

Gene hit At5g04380

 
Sequence (A. th genome BLAST matches underlined) 
>67-K023142-022-571-C09-8409
CTACCGAAATCGGCTACCTTAATGCATTTAGGAAAGTCCAAGTTTGTCAACATTTCCTCT
GTGTTTTAACTAAAATCGGATTGGGTATAAATAACACTCTTTTCTGAAACCATATATAAA
ACGCCTGTTAAGATCTGATACTTTAATGTGTGTACGCATG
GenBank Accession BX891886 [GenBank]
Graphic View Graphic view of gene At5g04380
Predicted Position of Insertion Chr5:1235229 - go to primer design
BLAST e Value 1e-46
Hit Clone Code (BAC ID) T19N18
Hit Gene Code At5g04380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation S-adenosyl-L-methionine-dependent methyltransferases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX891886 [GenBank]


Last Updated on 10.06.2021 13:37