SimpleSearch - Line and FST details


Line specific information

 
Line ID 582E02
Vector Used pAC161
Line Availability available as T3 set from NASC (N455826)
Segregation Analysis 60:56:34
Confirmed for Hit At2g40520
Parent of DUPLO pair 11836
Parent of pair(s) none

Gene hit At2g40520

 
Sequence (A. th genome BLAST matches underlined)
>13-K021690-022-582-E02-8409
ATGAACCATTTACAATTGAATATATCCTGAAACCTACATTTAAACTTCATTTATAGAAAC
CGGAAATCATGAAGTGTTCCTATGGGATCCTCCCTATAGTGAGGCGNNTTNNTCN
GenBank Accession BX654691 [GenBank]
Graphic View Graphic view of gene At2g40520
Predicted Position of Insertion Chr2:16924761 - go to primer design
BLAST e Value 9e-07
Hit Clone Code (BAC ID) T2P4
Hit Gene Code At2g40520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleotidyltransferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37