SimpleSearch - Line and FST details


Line specific information

 
Line ID 582E03
Vector Used pAC161
Line Availability available as T3 set from NASC (N455827)
Segregation Analysis 50:38:31
Confirmed for Hit At5g58090
Parent of DUPLO pair none
Parent of pair(s) 7520, 9281, 9288, 11343, 79037, 79038, 79039, 79040

Gene hit At5g58090

 
Sequence (A. th genome BLAST matches underlined) 
>21-K021690-022-582-E03-8409
AATGAAGCATTATACTCATAGTTGAACTGCATACCATATTCCAAATTCACATTATATGAC
CCCATAAGTAGTGCACAACCAATTTCCCCAATAATCATAAGAATGTTACCAAACCCATTC
TTCTCCAACGCGTGGACTATGGGATCCT
GenBank Accession BX654693 [GenBank]
Graphic View Graphic view of gene At5g58090
Predicted Position of Insertion Chr5:23506157 - go to primer design
BLAST e Value 4e-21
Hit Clone Code (BAC ID) K21L19
Hit Gene Code At5g58090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-Glycosyl hydrolases family 17 protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX654693 [GenBank]


Last Updated on 10.06.2021 13:37