SimpleSearch - Line and FST details


Line specific information

 
Line ID 583E05
Vector Used pAC161
Line Availability available as T3 set from NASC (N455925)
Segregation Analysis 50:39:32
Confirmed for Hit At5g20540
Parent of DUPLO pair none
Parent of pair(s) 2467

Gene hit At5g20540

 
Sequence (A. th genome BLAST matches underlined) 
>37-K021751-022-583-E05-8409
ATGGGAAAGAAAGTAGGTAAAAATTTAGAGAGAATGGGGACAGAGTTGTCGACAGTAACG
CTTCACGCCTAATGAGAAGCAAAGGCCGTAAAAGGTCCAAAAAGCAAAATTGGGTGTCTT
CTTTTTTTTTTTGATTTCTGTGATTATTTCTTCTCCTTTTGAGTTTTGGGGG
GenBank Accession BX654782 [GenBank]
Graphic View Graphic view of gene At5g20540
Predicted Position of Insertion Chr5:6949320 - go to primer design
BLAST e Value 2e-57
Hit Clone Code (BAC ID) F7C8
Hit Gene Code At5g20540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BREVIS RADIX-like 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX654782 [GenBank]


Last Updated on 10.06.2021 13:37