SimpleSearch - Line and FST details


Line specific information

 
Line ID 585E07
Vector Used pAC161
Line Availability available as T3 set from NASC (N456119)
Segregation Analysis 50:50:46
Confirmed for Hit At5g41700
Parent of DUPLO pair none
Parent of pair(s) 8581, 8595, 11306, 80814, 80836, 80838, 80841, 80842, 80843

Gene hit At5g41700

 
Sequence (A. th genome BLAST matches underlined) 
>53-K021753-022-585-E07-8409
GCAATAAGCCATTTACATTGAATATTACTACACTACACACAACACTTCACAGAAGCCAAG
CTTGTGCATTGAGCAAAATCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX654970 [GenBank]
Graphic View Graphic view of gene At5g41700
Predicted Position of Insertion Chr5:16677010 - go to primer design
BLAST e Value 2e-07
Hit Clone Code (BAC ID) MBK23
Hit Gene Code At5g41700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ubiquitin conjugating enzyme 8
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37